Molecular Detection of Brucella melitensis: A Case of Sheep Abortion in Tirunelveli, Tamil Nadu

Author:

S. Rajagunalan1*, C. Saranya Vellaiammal2, A. Ganesan3 and A. Sundar4

Journal Name: Biological Forum – An International Journal, 16(1): 342-346, 2024

Address:

1Assistant Professor, Department of Veterinary Public Health and Epidemiology, Veterinary College and Research Institute, TANUVAS, Tirunelveli (Tamil Nadu), India.

2Project Technical Support, Department of Veterinary Public Health and Epidemiology, Veterinary College and Research Institute, TANUVAS, Tirunelveli (Tamil Nadu), India.

3Assistant Professor, Department of Veterinary Gynaecology and Obstetrics, Veterinary College and Research Institute, TANUVAS, Tirunelveli (Tamil Nadu), India.

4Assistant Professor, Department of Veterinary Public Health and Epidemiology, Veterinary College and Research Institute, TANUVAS, Salem (Tamil Nadu), India.

(Corresponding author: S. Rajagunalan*)

DOI: -

PDF Download PDF

Abstract

Reproductive loss in farm animals can be caused by various etiological agents investigation of the cause of abortion will help in reducing further loss in the farm. Brucella melitensis is an important zoonotic pathogen causing brucellosis. This disease poses serious economic and public health challenges worldwide. This study investigates a case of sheep abortion that was identified using conventional and molecular detection methods like serological, staining, culture, and PCR-based methods. The causative agent was identified using a bcsp31 gene-based PCR assay and AMOS PCR and is supported by serological tests. The laboratory investigation revealed clear evidence of B. melitensis infection, providing critical insights into the epidemiology of brucellosis in sheep populations in this region. This case underscores the importance of routine molecular diagnostics for early detection of the causative agent and the need for public health interventions to mitigate the impact of this disease.


Keywords

Brucella melitensis, sheep, abortion, AMOS-PCR

Introduction

India hosts the world's largest livestock population, with over 535.82 million animals. Despite this, livestock productivity remains significantly lower; this is primarily due to poor health caused by multiple endemic infectious diseases (Bardhan et al., 2020; Khurana et al., 2021). Sheep farming, a key livelihood for small and marginal farmers in India, plays a vital role in socioeconomic development. With 6.8% of the global sheep population (FAOSTAT, 2010), sheep are efficient utilizers of poor-quality grass and crop residues, converting them into valuable resources such as meat and skin (Singaravadivelan et al., 2019). This is particularly relevant in the southern agro-climatic conditions of Tamil Nadu, where sheep farming sustains livelihoods under resource-constrained conditions (Ravimurugan et al., 2012).

Reproductive losses remain one of the significant challenges in sheep farming, with brucellosis being a major concern. Brucellosis is a highly prevalent zoonotic disease caused by bacteria of the genus Brucella. The primary species, including B. melitensis, B. abortus, and B. suis, cause severe reproductive complications in animals and pose significant public health risks (Whatmore and Foster 2021; Shome et al., 2021; Khurana et al., 2021). Other common infectious causes of abortion are campylobacteriosis, salmonellosis, leptospirosis, listeriosis, chlamydiosis, coxiellosis, blue tongue virus, and others (Vidić et al., 2007). In India, brucellosis leads to substantial economic losses due to abortion, retained placenta, endometritis, and infertility, with total losses estimated at Rs. 9,212 crores annually (Bardhan et al., 2020).

In sheep, abortion caused by B. melitensis typically occurs in the later stages of pregnancy. The bacteria spread through contact with aborted materials, contaminated feed and water, and direct exposure to infected animals. Infected rams can also serve as sources of transmission. High-density flocking practices further accelerate the spread of infection (Buxton and Henderson 1999).

Although multiple species of Brucella can infect sheep, B. melitensis is the most common, and clinical signs are often absent in non-pregnant animals (Mantur and Amarnath 2008; Sonekar et al., 2018). Transmission to humans occurs through direct contact with infected materials or consumption of unpasteurized milk and dairy products (Sonekar et al., 2018; Islam et al., 2023). Given the zoonotic potential and economic implications of brucellosis, early and accurate diagnosis is critical for effective disease control and management.

This study reports the detection of B. melitensis induced abortion in a sheep from Tirunelveli, Tamil Nadu, highlighting the importance of diagnosis in reducing reproductive losses and preventing zoonotic transmission of the pathogen.

Case presentation: A non-descript sheep was presented to the Veterinary Clinical Complex, Veterinary College and Research Institute, Tirunelveli with the history of abortion and retained fetal membrane. The serum sample and a small piece of fetal membrane were collected from the ewe and submitted to the Department of Veterinary Public Health and Epidemiology, VCRI, Tirunelveli for laboratory investigation.

Laboratory investigation: The sample was processed under aseptic conditions.

Serological testing: The serum was subjected to the Rose Bengal Plate Agglutination test (RBPT) by testing 30 microliters of antigen and 30 microliters of serum. The antibody titer was determined by the Brucella micro-agglutination test in a 96-well V-bottom plate as described by Baum et al. (1995); Sundar et al. (2020) using Brucella plain antigen. The plate was incubated overnight at 37 C, and the wells were examined for agglutination reaction, and the titer was determined by examining for the highest dilution of serum showing button formation in the bottom of the well against an oblique light.

Pathogen detection: From the fetal membrane, an impression smear was prepared from the freshly cut surface and was allowed to air dry and heat-fixed. The smear was then stained using the modified Ziehl Neelsen method (Alton et al., 1975) and examined under oil immersion. The freshly cut surface of the placenta was also used for inoculation of Brucella selective agar plates in duplicate, and one plate was incubated in a carbon dioxide incubator and the other under aerobic conditions at 37 C for 3 days. Bacterial colonies obtained were screened using PCR targeting the bcsp31 gene of Brucella, using DNA extracted from the colonies.

PCR-based detection: A small piece of the fetal membrane was used for DNA extraction using the Nucelospin Tissue DNA Extraction kit (Mackeral Nagel) as per the manufacturer's protocol and stored at -20 C. A PCR reaction was set up targeting the bcsp31 gene of Brucella in the presence of a positive control as described by Serpe et al. (1999). For identification of the species of Brucella, AMOS PCR was carried out as described by Bricker and Halling (1994). The details of the primers used are given in Table 1.

Results & Discussion

Abortion in sheep can result from both infectious and non-infectious causes, with significant economic and public health implications. Investigating the cause of abortion becomes crucial, especially if abortion rates exceed 2% in a farm. However, identifying the etiological agent remains challenging, with detection rates ranging between 32% and 55% due to factors such as improper sampling, multiple etiologies, limited diagnostic facilities, and high costs (Vidić et al., 2007).

In this case report, B. melitensis was identified as the causative agent of abortion in a sheep based on molecular diagnostic methods. Serological testing using the Rose Bengal Plate Agglutination Test (RBPT) revealed a positive result (Fig. 1). The Brucella Micro-Agglutination Test (B-MAT) indicated an antibody titer of 1:1280, supporting the diagnosis of brucellosis (Figure 2). Modified Ziehl-Neelsen (MZN) staining of the fetal membrane smear showed pink, cocco-bacillary organisms arranged individually or in small clusters, consistent with Brucella morphology (Figure 3). Although isolation of Brucella is considered the gold standard diagnostic method, it was unsuccessful in this case due to overgrowth of contaminating flora on selective media. This emphasizes the importance of collecting samples promptly and handling them under aseptic conditions to minimize contamination. Despite these challenges, PCR targeting the bcsp31 gene successfully detected DNA specific to Brucella organisms in the fetal membrane (Figure 4). Furthermore, AMOS-PCR identified the species as B. melitensis based on the presence of specific amplicons, confirming the diagnosis (Fig. 5). The use of DNA-based methods can overcome the difficulties of culture-based methods, facilitating accurate and rapid identification of Brucella (Londhe et al., 2010). Polymerase chain reaction-based methods are useful in the identification of Brucella from culture and clinical samples (Yu and Nielsen 2010). These methods are sensitive and rapid in providing results (Navarro et al., 2004). Several PCR assays have been developed for the diagnosis of brucellosis. Some of the genes targeted include bcsp31, 16S rRNA, IS711, BMEI1162, BMEII0466, alkB, eryC, and per (Liu et al., 2023). Amongst them, the bcsp31 gene is the most commonly used target, as it is present as a single-copy gene in the genome of Brucella (Ghodasara et al., 2010; Al-Dahouk et al., 2013; Liu et al., 2023). The AMOS PCR can give specific identification of Brucella species, and this assay has been used by several authors in the identification of the species of Brucella (Ewalt and Bricker 2000; Senthil et al., 2019; Parthiban et al., 2019; Saravanan et al., 2021).

Although B. ovis is the species specific to sheep (Olsen and Palmer 2014; Sarvanan et al., 2021), infection with B. melitensis is reported to be the most common species causing abortion in sheep in India (Upadhyay et al., 2019; Sarvanan et al., 2021). Sheep can acquire B. melitensis when these are raised along with goats, which is reported by other authors (Parthiban et al., 2019; Parthiban et al., 2021), and it is also a common practice in southern districts of Tamil Nadu that every sheep flock has a few goats raised along with sheep that could have played a role in the transmission of the disease. 

The findings align with previous studies indicating a high prevalence of brucellosis in Indian sheep populations. Nationwide surveillance has reported a seroprevalence of 11.55% in sheep (Shome et al., 2018), while a recent study in Tirunelveli district documented a prevalence of 19.25% using various serological tests (Sundar et al., 2020). Senthil et al. (2019) also detected B. melitensis in samples collected from aborted ruminants. Sharma et al. (2018) recorded a total of 15 abortions in two sheep flocks in Udaipur, Rajasthan, and isolated B. melitensis in these cases. Sarvanan et al. (2021) also detected B. melitensis among Mecheri sheep in Namakkal, Tamil Nadu. These findings highlight the endemic nature of brucellosis in the region and the urgent need for the implementation of control measures. This study underscores the utility of the molecular diagnostic method PCR in identifying Brucella species accurately. While conventional methods like culture remain valuable, they are time-consuming and resource-intensive. Combining molecular and serological diagnostics provides a more reliable approach to identifying brucellosis, especially in resource-limited settings. Early diagnosis and segregation of infected animals are crucial to prevent the spread of infection within flocks and to humans. This report of B. melitensis-induced abortion highlights the role of brucellosis in reproductive losses among sheep and its public health significance. The findings reinforce the importance of implementing robust diagnostic and control strategies to mitigate the impact of brucellosis on animal health, livelihoods, and public health.

Table 1: Details of the primes used in the present study.

Name

Sequences (5’-3’)

Amplicon size

Reference(s)

BCSP31-F

BCSP31-R

GGGCAAGGTGGAAGATTT

CGGCAAGGGTCGGTGTTT

443 bp

Serpe et al. (1999)

AMOS-Ab

AMOS-Me

AMOS-Ov

AMOS-Su

AMOS-IS711

GACGAACGGAATTTTTCCAATCCC

AAATCGCGTCCTTGCTGGTCTGA

CGGGTTCTGGCACCATCGTCG

GCGCGGTTTTCTGAAGGTTCAGG

TGCCGATCACTTAAGGGCCTTCAT

498 bp

731 bp

976 bp

285 bp

-

Bricker and Halling (1994)



C:\Users\Hpi3\Desktop\Submit Biology forum\BRuce\RBPT 1.jpg

Fig. 1. RBPT test showing characteristic agglutination reaction.

C:\Users\Hpi3\Desktop\Submit Biology forum\BRuce\BMAT.jpg

Fig. 2. B-MAT showing positive reaction.

C:\Users\Hpi3\Desktop\Submit Biology forum\BRuce\Microscope image.jpg

Fig. 3. Modified Ziehl Neelsen stained smear showing characteristic cocco-bacillary organisms against a blue background.

C:\Users\Hpi3\Desktop\Submit Biology forum\BRuce\BCSP.jpg

Fig. 4. Agarose gel showing bcsp31 specific amplicons, Lane M: 100 bp ladder, Lane 1: Positive control, Lane 2: Sample.

C:\Users\Hpi3\Desktop\Submit Biology forum\BRuce\AMOS.jpg

Fig. 5. Agarose gel showing AMOS PCR amplicons, Lane M: 100 bp ladder, Lane 1: Sample.

Conclusion

This report of B. melitensis-induced abortion highlights the role of brucellosis in reproductive losses among sheep and its public health significance. The findings reinforce the importance of implementing robust diagnostic and control strategies to mitigate the impact of brucellosis on animal health, livelihoods, and public health.


References

Al-Dahouk, S., Sprague, L. D. and Neubauer, H. (2013). New developments in the diagnostic procedures for zoonotic brucellosis in humans. Rev. Sci. Technol., 32, 177-88.

Alton, G. G., Jones, L. M. and Pietz, D. E. (1975). Laboratory Techniques in Brucellosis. Monograph Series. World Health Organization, Geneva, Switzerland. 

Bardhan, D., Kumar, S., Verma, M. R. and Bangar, Y. C. (2020). Economic losses due to brucellosis in India. Indian Journal of Comparative Microbiology, Immunology and Infectious Diseases41(1), 19-30.

Baum, M., Zamir, O., Bergman-Rios, R., Katz, E., Beider, Z., Cohen, A. and Banai, M. (1995). Comparative evaluation of microagglutination test and serum agglutination test as supplementary diagnostic methods for brucellosis. Journal of Clinical Microbiology, 33(8), 2166–2170.

Bricker, B. J. and Halling, S. M. (1994). Differentiation of Brucella abortus by 1, 2, and 4, Brucella melitensis, Brucella ovis and Brucella suisby PCR. Journal of Clinical Microbiology, 32, 2660-2666.

Buxton, D. and Henderson, D. (1999). Infectious abortion in sheep. In Practice21(7), 360-368.

Ewalt, D. R. and Bricker, B. J. (2000). Validation of the abbreviated Brucella AMOS PCR as a rapid screening method for differentiation of Brucella abortus field strain isolates and the vaccine strains, 19 and RB51. Journal of clinical microbiology38(8), 3085-3086.

FAOSTAT (2010). FAOSTAT Agriculture Data. Food and Agriculture Organization Statistics, Rome, Italy

Ghodasara, S. N., Roy, A. and Bhanderi, B. B. (2010). Comparison of rose bengal plate agglutination, standard tube agglutination and indirect ELISA tests for detection of Brucella antibodies in cows and buffaloes. Vet. World, 3, 61-64.

Islam, M. S., Islam, M. A., Rahman, M. M., Islam, K., Islam, M. M., Kamal, M. M. and Islam, M. N. (2023). Presence of Brucella spp. in Milk and Dairy Products: A Comprehensive Review and Its Perspectives. Journal of Food Quality, 1–19.

Khurana, S. K., Sehrawat, A., Tiwari, R., Prasad, M., Gulati, B., Shabbir, M. Z., Chhabra, R., Karthik, K., Patel, S. K., Pathak, M., Iqbal Yatoo, M., Gupta, V. K., Dhama, K., Sah, R. and Chaicumpa, W. (2021). Bovine brucellosis - a comprehensive review. Vet. Q., 41(1), 61-88.

Liu, L., Li, M., Liu, G., He, J., Liu, Y., Chen, X., Tu, Y., Lin, J., Feng, Y. and Xia, X. (2023). A novel, highly sensitive, one-tube nested quantitative real-time PCR for Brucella in human blood samples. Microbiol. Spectr., 11, e0058223.

Londhe, S. P., Bannalikar, A. S. and Dighe, V. D. (2010). Detection of Brucella abortus in buffalo blood and milk by IS711 PCR assay. J. Vety. Pub. Hlth., 8, 95-98.

Mantur, B. G. and Amarnath, S. K. (2008). Brucellosis in India—a review. Journal of biosciences33(4), 539-547.

Navarro, E., Casao, M. A. and Solera, J. (2004). Diagnosis of human brucellosis using PCR. Expert Rev Mol. Diagn., 4, 115-123.

Olsen, S. C. and Palmer, M. V. (2014). Advancement of knowledge of Brucella over the past 50 years. Veterinary pathology51(6), 1076-1089.

Parthiban, S., Prabhu, M., Anne, N. S., Malmarugan, S. and Rajeswar, J. J. (2019). Serum based screening and molecular detection of brucellosis in ruminants. Indian Journal of Biotechnology, 18, 22-25

Parthiban, S., Rajeswar, J. J., Thangathurai, R., Karthik, K., Gopal, K., Kumar, T. M. A. S., Raja, P. and Parthiban, M. (2021). Molecular Detection of Brucella melitensis Associated Reproductive Failure in Native Sheep Flock: Potential Public Health Pathogen from Tropical Region of Tamil Nadu. Journal of Immunology and Immunopathology, 23(2), 153-158.

Ravimurugan, T., Thiruvenkadan, T. R., Sudhakar, K. and Panneerselvam, S. (2012). Sheep genetic resources of southern Tamilnadu, India. International Research Journal of Agricultural Science and Soil Science, 2(3), 81-88

Saravanan, S., Saravanajeyam, M. and Palanivel, K. M. (2021). Molecular detection of Brucella melitensis in mecheri sheep. Indian Journal of Small Ruminants27(2), 297-300.

Senthil, N. R., Bharathi, M. V., Selvaraju, G., Manoharan, S. and Tirumurugan, K.G. (2019). Isolation and identification of Brucella melitensis from aborted ruminants. International Journal of Chemical Studies7, 535-538.

Serpe, L., Gallo, P., Fidenza, N., Scaramuzo, A. and Fenizia, D. (1999). Single step method for rapid detection of Brucella spp. in soft cheese by gene specific polymerase chain reaction. J. Dairy Res., 66, 313-317.

Sharma, D., Bhardwaj, B., Chouhan, H., Chandel, B., Joseph, B. and Barolia, S. (2018). Isolation and molecular characterization of Brucella melitensis from abortion storms in sheep with its zoonotic implications. International Journal of Current Microbiology and Applied Sciences7(10), 1348-1356.

Shome, R., Kalleshamurthy, T., Rathore, Y., Ramanjinappa, K. D., Skariah, S., Nagaraj, C., Mohandoss, N., Sahay, S. Shome, B. R., Kuralayanapalya, P., Roy, P. and Hemadri, D. (2021). Spatial sero-prevalence of brucellosis in small ruminants of India: Nationwide cross-sectional study for the year 2017–2018. Transboundary and Emerging Diseases68(4), 2199-2208.

Shome, R., Sahay, S., Triveni, K., Krithiga, N., Shome, B. R. and Rahman, H. (2018). Evidence of ovine brucellosis due to Brucella ovis and Brucella melitensis in Karnataka, India. The Indian Journal of Animal Sciences88(5), 522-525.

Singaravadivelan, A., Kumaravelu, N., Vijayakumar, P. and Sivakumar, T. (2019). An economic analysis of migratory sheep production system in Tamil Nadu, India. J. Anim. Health Prod.7(2), 58-64.

Sonekar, C. P., Kale, S., Bhoyar, S., Paliwal, N., Shinde, S. V., Awandkar, S. P., Khan, W.,  Chaudhari, S. P. and Kurkure, N. V. (2018). Brucellosis in migratory sheep flock from Maharashtra, India. Tropical Animal Health and Production50(1), 91-96.

Sundar, A., Rajagunalan, S. and Sangameswaran, R. (2020). Serological Detection of Brucellosis among Small Ruminants in Tirunelveli District, Tamil Nadu, India. Int. J. Curr. Microbiol. App. Sci.9(6), 4283-4288.

Upadhyay, A. K., Maansi, Singh, P. and Nagpal, A. (2019). Epidemiology of brucellosis in India: a review. Pantnagar Journal of Research, 17, 199-205.

Vidić, B., Savić-Jevđenić, S., Grgić, Ž., Bugarski, D. and Maljković, M. (2007). Infectious abortion in sheep. Biotechnology in Animal Husbandry23, 383-389.

Whatmore, A. M. and Foster, J. T. (2021). Emerging diversity and ongoing expansion of the genus Brucella. Infection, Genetics and Evolution92, 104865.

Yu, W.L. and Nielsen, K. (2010). Review of detection of Brucella spp. by polymerase chain reaction. Croat. Med. J., 51, 306-313.

How to cite this article

S. Rajagunalan, C. Saranya Vellaiammal, A. Ganesan and A. Sundar  (2024). Molecular Detection of Brucella melitensis: A Case of Sheep Abortion in Tirunelveli, Tamil Nadu. Biological Forum – An International Journal, 16(1): 342-346.